Genetic Analysis of Methylenetetrahydrofolate Reductase (MTHFR) Gene of Polymorphism (rs1801133) in Patients with Non-Syndromic Cleft lip and Palate in the South Indian Population. A Preliminary Case Control Study

 

Gorde:
Xehetasun bibliografikoak
Egileak: Felicita, A. Sumathi, Kamala devi. S, Vijayashree Priyadharshini Jayaseelan
Formatua: artículo original
Egoera:Versión publicada
Argitaratze data:2026
Deskribapena:To identify if an association exists between MTHFR gene polymorphism (rs1801133) and non-syndromic cleft lip (NSCLP) and palate in patients belonging to the South Indian population. 25 patients with NSCLP and 25 healthy patients as controls were enrolled in the study.  Genotyping of rs1801133 polymorphism was performed with PCR and amplification refractory mutation system. The primers used were MTHFR-Forward: 5’- TGCTGTTGGAAGGTGCAAGAT - 3’, MTHFRR1: 5’ - GCGTGATGATGAAATCGG - 3’ and MTHFRR2: 5’ - GCGTGATGATGAAATCGA - 3’. Cycling was carried out with an annealing temperature of 58 degree C for 30 seconds Genotype and allele frequency distributions in both the groups were compared using Chi-square test. The frequency of the GA was 100% without GG and AA genotype in group 1 (case group). The allele frequency in group 2 (control group) was found to be GG=24% and GA=76%. The GG homozygous genotype was absent in the case group, whereas the AA homozygous genotype was absent in boths groups. There was a statistically significant deviation from Hardy Weinberg Equilibrium with a p value of <0. 00001 and <0.0022 in the case group control group respectively. Both the groups showed a deviation in Hardy- Weinberg equilibrium depicting an evolving genotyping variant in the South Indian population. Classification of the genotypes based on genetic models such as dominant, recessive or additive did not present any significant association of the polymorphism marker with disease status.
Herria:Portal de Revistas UCR
Erakundea:Universidad de Costa Rica
Repositorio:Portal de Revistas UCR
Hizkuntza:Inglés
OAI Identifier:oai:portal.revistas.ucr.ac.cr:article/5223
Sarrera elektronikoa:https://revistas.ucr.ac.cr/index.php/rOdontos/article/view/5223
Gako-hitza:MTHFR gene; rs1801133; Non syndromic; Cleft lip and palate; Polymorphism; Genetic variation.
Gen MTHFR; rs1801133; No sindrómico; Labio y paladar hendido; Polimorfismo; Variación genética.